Previous PagePREV

|

48 of 72

|

NEXTNext Page
Lights Canvas Print featuring the photograph Atgcgtagcgtagtcgtagca by Ugne Paulauskaite

Frame

Top Mat

Top Mat

Bottom Mat

Bottom Mat

Dimensions

Image:

8.00" x 8.00"

Overall:

8.00" x 8.00"

 

Share This Page

Atgcgtagcgtagtcgtagca Canvas Print

$36.70

Product Details

Atgcgtagcgtagtcgtagca canvas print by Ugne Paulauskaite.   Bring your artwork to life with the texture and depth of a stretched canvas print. Your image gets printed onto one of our premium canvases and then stretched on a wooden frame of 1.5" x 1.5" stretcher bars (gallery wrap) or 5/8" x 5/8" stretcher bars (museum wrap). Your canvas print will be delivered to you "ready to hang" with pre-attached hanging wire, mounting hooks, and nails.

Design Details

ATGCGTAGCGTAGTCGTAGCA

Ships Within

3 - 4 business days

You May Also Like

Visai Nekalėdiškos Nuotaikos Canvas Print / Canvas Art by Ugne Paulauskaite
#yankee #candle #black #cherry Canvas Print / Canvas Art by Ugne Paulauskaite
And Then I Ran Out Of Scotch Tape Canvas Print / Canvas Art by Ugne Paulauskaite
Le Seeing Town's Christmas Tree For De Canvas Print / Canvas Art by Ugne Paulauskaite
More Canvas Prints from Ugne Paulauskaite

Featured Canvas Prints

Awesome Solitude Canvas Print / Canvas Art by Bess Hamiti
On Our Way  Canvas Print / Canvas Art by Ryan Weddle
Art Deco Black Canvas Print / Canvas Art by Elisabeth Fredriksson
Beyond our Imagination Canvas Print / Canvas Art by Jorge Maia
Indigo Mountains Canvas Print / Canvas Art by Spacefrog Designs
Docking Station Canvas Print / Canvas Art by Stephie Jones
Green Blue Canvas Print / Canvas Art by Julie Niemela
The Fox and the Forest Canvas Print / Canvas Art by Nic Squirrell
Swimming Girl #1 Canvas Print / Canvas Art by Giuseppe Cristiano
Models Sitting On Sand Dunes Canvas Print / Canvas Art by Clifford Coffin
Moon Hug Canvas Print / Canvas Art by Digital Carbine
A Male Model Underwater In A Pool With A Scuba Canvas Print / Canvas Art by Leonard Nones
Colosseum Canvas Print / Canvas Art by Dave Bowman
Tree Clouds 01d2 Canvas Print / Canvas Art by Aimelle Ml
Tropical Green Leaves Pattern  Canvas Print / Canvas Art by Mark Ashkenazi
Shop Canvas Prints

Additional Products

Atgcgtagcgtagtcgtagca Photograph by Ugne Paulauskaite

Photograph

Atgcgtagcgtagtcgtagca Canvas Print

Canvas Print

Atgcgtagcgtagtcgtagca Framed Print

Framed Print

Atgcgtagcgtagtcgtagca Art Print

Art Print

Atgcgtagcgtagtcgtagca Poster

Poster

Atgcgtagcgtagtcgtagca Metal Print

Metal Print

Atgcgtagcgtagtcgtagca Acrylic Print

Acrylic Print

Atgcgtagcgtagtcgtagca Wood Print

Wood Print

Atgcgtagcgtagtcgtagca Greeting Card

Greeting Card

Atgcgtagcgtagtcgtagca iPhone Case

iPhone Case

Canvas Print Tags

wall art canvas prints christmas canvas prints lights canvas prints biology canvas prints genetics canvas prints dna canvas prints studying canvas prints inspiration canvas prints

Photograph Tags

photographs christmas photos lights photos biology photos genetics photos dna photos studying photos inspiration photos

Comments (0)

There are no comments for Atgcgtagcgtagtcgtagca.   Click here to post the first comment.

About Canvas Prints

Framed Canvas Prints
Gallery Wrap Corner

Corner Detail: Stretched canvas print with 1.5" stretcher bars and mirrored image sides.   Also available with black sides, whites sides, and 5/8" stretcher bars.

Bring your artwork to life with the texture and depth of a stretched canvas print.   Your image gets printed on one of our premium canvases and then stretched on a wooden frame of 1.5" x 1.5" stretcher bars (gallery wrap) or 5/8" x 5/8" stretcher bars (museum wrap).   All stretched canvases ship within 3 - 4 business days and arrive "ready to hang" with pre-attached hanging wire, mounting hooks, and nails.

Stretched canvas prints look beautiful with or without frames.

Mobile Prints is one of the largest, most-respected giclee printing companies in the world with over 40 years of experience producing museum-quality prints.   All of our prints are produced on state-of-the-art, professional-grade Epson printers.   We use acid-free papers and canvases with archival inks to guarantee that your prints last a lifetime without fading or loss of color.

Canvas Print Reviews (14073)

Average Rating (4.81 Stars):

Star Rating Full Star Rating Full Star Rating Full Star Rating Full Star Rating Empty

David O'CONNOR

April 24th, 2024

Star Rating Full Star Rating Full Star Rating Full Star Rating Full Star Rating Full
Product Review Image

Very happy. Grew up with this picture and show.

Lee Alexander

April 24th, 2024

Star Rating Full Star Rating Full Star Rating Full Star Rating Full Star Rating Full
Product Review Image

Beautiful! Looks great in our dining room!

Lee Alexander

April 24th, 2024

Star Rating Full Star Rating Full Star Rating Full Star Rating Full Star Rating Full
Product Review Image

Beautiful! Looks great in our dining room!

Lee Alexander

April 24th, 2024

Star Rating Full Star Rating Full Star Rating Full Star Rating Full Star Rating Full
Product Review Image

Beautiful! Looks great in our dining room!

Scott Rosey

April 24th, 2024

Star Rating Full Star Rating Full Star Rating Full Star Rating Full Star Rating Full
Product Review Image

Great canvas and framing. A decent shipping time, and EXCEPTIONAL safe packaging. Just an appropriate image for my viewing/listening room. Just took the speaker grills off for this photo.

Artist's Description

ATGCGTAGCGTAGTCGTAGCA

Shop with Confidence

Satisfaction Guarantee

Our return policy is very simple:

 

If you're not happy with a purchase that you made on MobilePrints.com, for any reason, you can return it to us within 30 days of the order date.   As soon as it arrives, we'll issue a full refund for the entire purchase price.   Please note - Mobile Prints does not reimburse the outgoing or return shipping charges unless the return is due to a defect in quality.

 

Mobile Prints sells thousands of pieces of artwork each month - all with a 100% money-back guarantee.   We take great pride in the fact that hundreds of thousands of artists have chosen Mobile Prints to fulfill their orders, and we look forward to helping you select your next piece!

Delivery

All canvas prints ship from our production facility within 3 - 4 business days of your order.

 

$36.70

Previous Page Next Page